For viral RNA extraction experiments and qPCR tests, CD-2019-nCoV-abn can be used as a positive control. Retrovirus envelope and nucleic acid sequences make up the pseudovirus. Chemical synthesis is used to acquire nucleic acid from the ORF1a/b gene sequence and the Gene N coding area sequence of 2019-nCoV, which is then cloned into a retrovirus vector. The pseudovirus was grown in 293T cells before being concentrated and purified using ultra-fast centrifugation.
Application:
It can be used as a positive control for viral RNA extraction experiment and qPCR test.
Components:
*The main ingredients including glucose, potassium dihydrogen phosphate, disodium phosphate, sodium chloride, potassium chloride, and CD-2019-nCoV-abn pseudoviruses.
Structure and sequences:
1. N Gene SEQ
AGTTCAAGAAATTCAACTCCAGGCAGCAGTAGGGGAACTTCTCCTGCTAGAATGGCTGGCAATGGCGGTGATGCTGCTCTTGCTTTGCTGCTGCTTG ACAGATTGAACCAGCTTGAGAGCAAAATGTCTGGTAAA
2. ORF1a/b SEQ
TAATGACCCTGTGGGTTTTACACTTAAAAACACAGTCTGTACCGTCTGCGGTATGTGGAAAGGTTATGGCTGTAGTTGTGATCAACTCCGCGAACCC ATGCTTCAGTCAGCTGATGCACAATCGTTTTTAAACGGGTTTGCGGTGTAA
Storage:
The components should be stored at -20°C and is stable for 6 months.
Specifications:
| Application | It can be used as a positive control for viral RNA extraction experiment and qPCR test. |
Virus Extraction Kits
| Cat. No. | Product Name | Specs | |
|---|---|---|---|
| DCE008 | CD Viral DNA&RNA Kit | 50 | View product page |
| DCE102 | CD Magnetic Viral DNA&RNA Kit | 50 / 200 | View product page |
Positive Control
| Cat. No. | Product Name | Specs | |
|---|---|---|---|
| MD003 | CD-2019-nCoV-abEN | 1ml / 5ml / 10ml | View product page |
One Step qRT-PCR Kits
| Cat. No. | Product Name | Specs | |
|---|---|---|---|
| QRT001 | CD One Step qRT-PCR SYBR Green Kit | 250 / 100 | View product page |
| QRT002 | CD One Step qRT-PCR Probe Kit | 250 / 100 | View product page |
NGS Metagenome Preparation Kits
| Cat. No. | Product Name | Specs | |
|---|---|---|---|
| DP001 | CD Universal DNA Library Prep Kit for Illumina | 24 / 96 / 24(PCR-free) / 96(PCR-free) | View product page |
| DP002 | CD NEXT DNA Library Prep Kit for Illumina | 24(50ng) / 96(50ng) / 24(5ng) / 96(5ng) / 24(1ng) / 96(1ng) | View product page |
| CB001 | CD DNA Clean Beads | 5ml / 60ml / 450ml | View product page |
| DSI001 | CD DNA Adapters S1-S2 for Illumina | 48 / 192 / 48 / 192 | View product page |
| DSI002 | CD DNA Adapters S3-S6 for Illumina | 192 / 192 / 192 / 192 | View product page |
| DDI001 | CD Multiplex Oligos S1 for Illumina | 192 | View product page |
| DDI002 | CD Multiplex Oligos S2 for Illumina | 192 | View product page |
| DDI003 | CD NEXT Index Kit S1 for Illumina | 192 | View product page |
| DDI004 | CD NEXT Index Kit S2 for Illumina | 768 | View product page |
| DDI005 | CD NEXT Index Kit S3 for Illumina | 192 / 192 / 192 / 192 | View product page |
- Melting of pseudovirus: remove the pseudovirus from the refrigerator at -20°C, melt it in an ice bath or put it in 4 °C, and then conduct the experimental operations after it has completely melted;
- Inactivation (optional) of pseudovirus: absorb the required amount of pseudovirus in the biological safety cabin and inactivate it in the EP tube at 56°C for 30min;
- RNA extraction and qPCR detection of pseudovirus: carry out relevant experimental operations according to the instructions of nucleic acid extraction kit and qPCR detection kit.
Notes:
- Repeated freezing-thawing should be avoided. Freezing-thawing will reduce the stability of the pseudovirus, thus affecting the effect of nucleic acid extraction and qPCR test results;
- If the product needs to be diluted, phosphate buffer (PBS) or normal saline (0.9% NaCl) can be used;
- In case of accidental splash to eyes, skin, or other body parts, please immediately rinse with plenty of water;
- The experimental wastes generated using this product shall be treated according to the requirements of medical waste treatment after high-pressure sterilization.
