CD Multiplex Oligos S2 for Illumina

CAT Specs Inquiry Basket
DDI002 192

CD Multiplex Oligos S2 for Illumina is specially designed for CD Universal DNA Library Prep Kit. The kit contains CD Adapter-S for Illumina, 8 kinds of 8bp indexed i5 and 12 kinds of 8bp i7. The dual-indexed adapter can be used to distinguish different samples. All Kit components are subjected to stringent quality control. Library Structure: 5´AATGATACGGCGACCACCGAGATCTACAC[i5]ACACTCTTTCCCTACACGACGCTCTTCCGATC- Insert DNA Sequence -5´-GATCGGAAGAGCACACGTCTGAACTCCAGTCAC[i7]ATCTCGTATGCCGTCTTCTGCTTG-3´

CD Universal DNA Library Prep Kit is compatible with CD Multiplex Oligos S2 for Illumina. Various samples can be distinguished using the dual-indexed adapter. It provides adaptors and primers for multiplex Illumina library production with a high yield. It also enables index incorporation during library amplification

Components:

Components of CD Multiplex Oligos S2 for Illumina
Components of CD Multiplex Oligos S2 for Illumina

Application:

Dedicated adapter primer kit for CD Universal DNA Library Prep Kit for Illumina (DP001), suitable for the generation of double-ended Indexed libraries for Illumina high-throughput sequencing platform.

Storage:

All the components can be stored at -20℃ for one year.

Specifications:

Application Used for CD Universal DNA Library Prep Kit for Illumina
Sequencing Platform Illumina

Adapter-S for Illumina

5´-ACACTCTTTCCCTACACGACGCTCTTCCGATC-s-T-3´ 3´-CTGACCTCAAGTCTGCACACGAGAAGGCTAG-p-5´ (-s- indicates thio, and -p indicates phosphorylation)

i5 PCR Primers

5´-AATGATACGGCGACCACCGAGATCTACAC [i5] АСАСТСТТТСССТАСАСGAСGСTCTTCCGATC-3´

i7 PCR Primers

5´-CAAGCAGAAGACGGCATACGAGAT [i7] GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC-s-T-3´

(-s- indicates thio)

*[i5] represents an 8 nt i5 Index sequence, and [i7] represents an 8 nt i7 Index sequence.

The index name corresponding to each primer, the Index sequence included in the primer, and the Index sequence information input in the Sample Sheet at the time of sequencing are as follows:

Index sequence information for CD Multiplex Oligos S2 for Illumina
Index sequence information for CD Multiplex Oligos S2 for Illumina


* For Research Use Only. Not for use in diagnostic procedures.

We provide high-quality kit products for researchers from across the world, meeting the needs of various nucleic acid-related experiments.

Copyright © CD Genomics. All rights reserved.
Top
0
Inquiry Basket