Fungal Whole-Genome De Novo Sequencing — Telomere-to-Telomere Assembly by PacBio & Nanopore

Complete fungal genome assembly from PacBio HiFi (Sequel II / Revio), Oxford Nanopore PromethION R10.4.1, and hybrid strategies — producing gapless, telomere-to-telomere assemblies for pathogenic fungi, industrial strains, model organisms, and environmental isolates across all fungal phyla

CD Genomics provides fungal whole-genome de novo sequencing on PacBio HiFi, Oxford Nanopore PromethION R10.4.1, and Illumina platforms — producing telomere-to-telomere, gapless assemblies for pathogenic, industrial, and environmental fungi across all major phyla. Our service is tailored to fungal genome complexities including AT-rich repeat resolution, diploid-aware phasing, accessory chromosome capture, and comprehensive annotation with CAZy, antiSMASH, and effector prediction databases.

Fungal whole-genome de novo sequencing is the process of reconstructing a complete genome sequence for a fungal species or strain from scratch, without reliance on a pre-existing reference genome. Unlike resequencing — which identifies differences relative to a known reference — de novo assembly builds the genome directly from sequencing reads, producing the complete set of chromosomes, mitochondrial genome, and any extrachromosomal elements. This approach is essential for characterizing novel fungal isolates, species without a high-quality reference, or strains where the existing reference is incomplete or misrepresentative.

Fungal genomes present unique challenges that make long-read sequencing especially valuable. At 10–100+ Mb with highly repetitive AT-rich regions, complex secondary metabolite gene clusters, variable numbers of accessory chromosomes, and often-difficult telomere-to-telomere resolution, fungal genomes require the read length and accuracy that only PacBio HiFi and Oxford Nanopore technologies can provide. Short-read assemblies of fungal genomes are typically fragmented into hundreds of contigs with collapsed repeats, incomplete telomeres, and misassembled biosynthetic gene clusters — limitations that long-read sequencing overcomes by spanning repetitive elements and producing complete chromosomal assemblies in a single contig per chromosome.

At CD Genomics, we provide fungal WGS de novo sequencing across all major platforms — PacBio HiFi, Oxford Nanopore PromethION, and Illumina NovaSeq — with tailored strategies for genome size, ploidy level, repeat content, and project budget. Our bioinformatics pipelines are optimized for fungal genome complexities including diploid-aware phasing, accessory chromosome resolution, and comprehensive functional annotation with fungal-specific databases.

Why Choose Our Fungal WGS De Novo Sequencing Service

• Telomere-to-Telomere Fungal Genomes — Long reads spanning repeat arrays, rDNA clusters, and subtelomeric regions produce gapless assemblies with complete telomere resolution at both ends of every chromosome — assemblies that short-read methods cannot achieve
• Platform-Optimized for Fungal Genome Complexity — Custom assembly pipelines for AT-rich genomes, diploid/dikaryotic strains (phased assemblies with hifiasm / HiCanu), accessory chromosome identification, and rDNA array resolution — not a one-size-fits-all bacterial pipeline applied to fungi
• Fungal-Specific Functional Annotation — Beyond standard gene prediction, our annotation includes carbohydrate-active enzymes (CAZy), secondary metabolite gene clusters (antiSMASH), secreted proteins and effectors, mating-type loci, and transposable element landscapes — using databases and tools calibrated for fungal genomes
• Scalable From Yeasts to Large Filamentous Fungal Genomes — Coverage and chemistry recommendations scaled to genome size: 30–50× HiFi for yeasts (~10–20 Mb), 50–100× HiFi for filamentous fungi (~30–80 Mb), with optional Hi-C for chromosome-scale scaffolding when ultra-long reads alone are insufficient
• Integrated Multi-Kingdom Expertise — Our team has completed fungal WGS projects across Ascomycota, Basidiomycota, Mucoromycota, and early-diverging fungal lineages — from pathogenic Candida and Aspergillus species to industrial Trichoderma and Saccharomyces strains to environmental mycorrhizal fungi
• Publication-Ready Deliverables — Complete annotated genome with chromosomal pseudomolecules, GenBank/EMBL submission files, comprehensive annotation report, and data visualizations including chromosome maps, synteny plots, and comparative genomics figures

What Is Fungal Whole-Genome De Novo Sequencing — and Why Long Reads Are Essential

Fungal whole-genome de novo sequencing assembles a complete genome sequence for a fungal species or strain entirely from sequencing reads, without relying on a reference genome for guidance. The output is a set of chromosomal pseudomolecules — ideally one contiguous sequence per chromosome, with telomeres at both ends, the complete mitochondrial genome, and any plasmid or double-stranded RNA viral elements — representing the first complete genomic description of the target organism.

Fungal genomes span a remarkable range of size and complexity. Unicellular yeasts such as Saccharomyces cerevisiae have compact ~12 Mb genomes with few repeats, while filamentous fungi like Aspergillus species range from 30–40 Mb with moderate repeat content, and plant pathogens like Puccinia or Blumeria exceed 100 Mb with extremely high repeat densities (>80% transposable elements). Many fungal species also carry accessory (conditionally dispensable) chromosomes that are present in some strains but absent in others — often harboring virulence factors, host-range determinants, or secondary metabolite clusters that are invisible in assembly drafts that collapse or discard them. Short-read sequencing systematically under-assembles these complex regions: repeats collapse, accessory chromosomes fragment, rDNA arrays remain as gaps, and telomeres are lost entirely.

Long-read sequencing transforms fungal genome assembly. A single PacBio HiFi read (15–25 kb, Q30+) or ONT ultra-long read (50–100+ kb) can span an entire transposable element, resolve a multi-gene secondary metabolite cluster in its chromosomal context, bridge an rDNA repeat unit, and connect the subtelomeric region to the chromosome end. With sufficient coverage and appropriate assembly algorithms (hifiasm, Flye, CANU, HiCanu), long-read assemblies routinely produce telomere-to-telomere fungal genomes with no gaps, no uncollapsed repeats, and complete chromosomal structure.

At CD Genomics, our fungal WGS de novo service is designed around the specific biological and technical requirements of fungal genomics — from AT-rich genome assembly optimization and diploid phasing to fungal-specific annotation pipelines — delivering complete genome blueprints for research, biotechnology, and agricultural applications.

Fungal Genome Assembly Applications — From Clinical Pathogens to Industrial Strains

Beyond pathogen and industrial genomics, long-read fungal genome assembly is increasingly applied in natural product drug discovery, where complete resolution of biosynthetic gene clusters (BGCs) in their native chromosomal context enables the identification of novel polyketide synthase (PKS) and non-ribosomal peptide synthetase (NRPS) clusters that are fragmented or collapsed in short-read assemblies — opening access to previously hidden fungal secondary metabolite diversity for pharmaceutical development.

Medical Mycology & Pathogen Genomics

• Complete genome assembly of emerging fungal pathogens (Candida auris, Aspergillus fumigatus, Cryptococcus neoformans) for understanding virulence mechanisms, antifungal resistance determinants, and population structure
• Identification and genomic characterization of novel fungal pathogens through phylogenetic placement and comparative genomics against assembled reference genomes
• Antifungal resistance mechanism discovery: resolution of tandem gene amplifications, copy number variation in resistance loci, and subtelomeric gene family expansions associated with drug tolerance
• Within-host evolution tracking during chronic fungal infections through serial isolate genome assembly and comparison

Agricultural & Plant Pathology

• De novo assembly of plant pathogenic fungal genomes for understanding host-range determinants, effector protein evolution, and race-specific virulence factors
• Characterization of accessory chromosomes carrying host-specific pathogenicity genes in Fusarium, Alternaria, and Leptosphaeria species
• Complete genome assembly of biocontrol fungi (Trichoderma, Beauveria, Metarhizium) to characterize mycoparasitism genes, insecticidal toxins, and secondary metabolite repertoires
• Genome-enabled breeding of edible and medicinal fungi (Lentinula edodes, Ganoderma lucidum, Pleurotus ostreatus) through complete genomic characterization of cultivated strains

Industrial & Biotechnology

• Complete genome assembly of industrial workhorse species (Saccharomyces cerevisiae, Aspergillus niger, Trichoderma reesei, Komagataella phaffii) for strain improvement, metabolic engineering, and synthetic biology
• Secondary metabolite gene cluster discovery: long-read resolution of complete biosynthetic gene clusters (polyketide synthases, non-ribosomal peptide synthetases) in their native chromosomal context — essential for natural product discovery and heterologous expression
• CAZyome characterization: comprehensive annotation of carbohydrate-active enzyme repertoires for biomass degradation, biofuel production, and biorefinery applications
• Comparative genomics of industrial strains to identify beneficial mutations, gene duplications, and genomic rearrangements underlying improved production phenotypes

Evolutionary & Environmental Mycology

• Telomere-to-telomere genome assemblies for phylogenetic and phylogenomic analyses across fungal diversity — providing complete data for evolutionary studies without the biases introduced by fragmented assemblies
• Transposable element landscape characterization: complete repeat annotation across fungal genomes for understanding genome evolution, repeat-induced point mutation (RIP), and the role of TEs in adaptive evolution
• Mating-type locus resolution: complete assembly of the often-repetitive and structurally variable mating-type loci in both heterothallic and homothallic fungi
• Mycorrhizal and lichenized fungal genome assembly for understanding symbiosis mechanisms, nutrient exchange, and co-evolution with plant hosts

Fungal Genome Annotation — CAZy, antiSMASH, Effector Prediction & Custom Analysis

Our fungal genome annotation pipeline is specifically designed for fungal biology, incorporating kingdom-specific tools and databases that go beyond generic genome annotation workflows.

Getting Started — Sample Requirements for Fungal WGS De Novo Sequencing

Case Study: PacBio HiFi Closes 80 Gaps and Resolves Subtelomeric Gene Families in the Candida albicans Reference Genome

Hoyer LL, Freeman BA, Hogan EK, Hernandez AG. Use of a Candida albicans SC5314 PacBio HiFi reads dataset to close gaps in the reference genome assembly, reveal a subtelomeric gene family, and produce accurate phased allelic sequences. Frontiers in Cellular and Infection Microbiology. 2024;14:1329438. doi:10.3389/fcimb.2024.1329438.

1. Background

Candida albicans is the most prevalent human fungal pathogen and a leading cause of invasive candidiasis in immunocompromised patients. The SC5314 reference genome (assembly ASM18296v3) was originally assembled from Sanger and short-read sequencing and contained 80 spanned sequence gaps (regions of Ns) — unresolved repetitive regions, rDNA arrays, and complex genomic loci that short-read technologies could not assemble. These gaps included critical genomic features such as subtelomeric regions, the rDNA locus on chromosome R, and genes encoding the ALS (agglutinin-like sequence) adhesin family — key virulence factors whose complete sequences were essential for understanding C. albicans pathogenesis but remained fragmented or missing from the reference.

In this study, Hoyer et al. generated PacBio HiFi sequencing data for the SC5314 strain and used it to produce an updated de novo assembly that systematically resolved all 80 gaps and completed the genome.

2. Methods

PacBio HiFi reads were generated on the Sequel IIe system (two SMRT Cells, 6 kb and 13 kb library sizes) and assembled using hifiasm to produce a collapsed haploid telomere-to-telomere assembly (ASM3268872v1). The new assembly was compared to the existing ASM18296v3 reference using MUMmer alignment, gap analysis, and manual inspection of previously unresolved loci. Telomeric repeats were identified by searching for the C. albicans telomere repeat sequence (GGTGTACGGATGTCTAACTTCTT) at chromosome ends. Individual HiFi read alignments were used to resolve the diploid sequence of the ALS gene family.

3. Results

Figure 2. Comparison of the previous C. albicans reference assembly (ASM18296v3, 88 contigs, 80 gaps) with the updated PacBio HiFi assembly (ASM3268872v1, 8 contigs — one per chromosome, zero gaps). The new assembly added telomeric repeats to all 16 chromosome ends and discovered a conserved family of DNA helicase-encoding (YRF1) genes at 10 of 16 subtelomeric regions. Adapted from Hoyer et al. (2024), Frontiers in Cellular and Infection Microbiology, CC BY 4.0.

Key Findings

• Gap closure: The PacBio HiFi assembly closed all 80 spanned gaps present in the previous reference — from 88 contigs (N50 = 334 kb) to 8 contigs (one per chromosome, N50 = 2.27 Mb) with zero gaps genome-wide.
• Telomere completion: The previous reference contained no telomeric repeats at any chromosome end. The HiFi assembly added telomeric repeats to all 16 chromosome ends, with subtelomeric regions extending up to 19 kb beyond the previous chromosome ends — recovering entire subtelomeric gene content previously missing.
• Novel gene family discovery: A family of highly conserved DNA helicase-encoding genes (YRF1) was discovered at 10 of 16 subtelomeric regions — a gene family previously unrecognized in C. albicans that had been completely missed due to the fragmented assembly of subtelomeric regions.
• ALS gene family resolution: Individual HiFi read alignments enabled accurate resolution of the diploid sequences for the ALS adhesin gene family — notoriously difficult to assemble due to highly repetitive tandem repeat domains — providing the first complete view of these key virulence determinants.

4. Conclusions

This study demonstrates that PacBio HiFi sequencing alone — without additional platforms — can produce a complete, telomere-to-telomere fungal genome assembly that resolves regions intractable to short-read approaches for over a decade. The 8-contig assembly (one per chromosome), complete telomere resolution, and discovery of a previously hidden gene family illustrate the transformative impact of long-read de novo sequencing on fungal genomics. The approach is directly applicable to any fungal species for which a complete genome sequence is desired.

Deliverables — What You Receive with Every Fungal Genome Project

Deliverable Examples for Fungal WGS De Novo Sequencing Projects

1. Complete genome assembly file (FASTA) with chromosomal pseudomolecules — each chromosome as a single contiguous sequence with telomeric repeats at both ends, plus mitochondrial genome and any accessory chromosomes or extrachromosomal elements.

2. Genome annotation file (GFF3/GenBank format) with structural and functional annotations — protein-coding genes, tRNA, rRNA, ncRNA, repeat annotations, and predicted functional domains with cross-references to CAZy, antiSMASH, PHI-base, and KEGG.

3. Circular genome visualization (CGView/Circos) showing multi-track chromosomal maps with CDS features, repeat density, secondary metabolite cluster locations, GC content, and GC skew — publication-ready format.

4. Comprehensive project report PDF documenting experimental methods, sequencing QC metrics, assembly statistics, annotation summary, and detailed methods text suitable for manuscript preparation.

Figure 3. Representative deliverable formats for fungal WGS de novo sequencing projects. Left: multi-track chromosome map with CDS, repeats, and SM clusters. Center: CAZy and antiSMASH annotation summary. Right: assembly QC metrics and comparative genomics. AI-generated representative data.